miRNA Mature hsa-miR-10392-5p [Human]

The following mature miRNA have the same seed sequence: CGCUUCG

ID	hsa-miR-10392-5p
Accession	MIMAT0041615
Sequence	1 - GCGCUUCGACGGGCUGGGCUGUG - 23
Seed Sequence	CGCUUCG

miRNA-Specific Assays for Results You Can Trust

Streamline your workflow with assays designed for this miRNA. Our targeted qPCR assays help you generate meaningful data – efficiently and accurately.

Functional Analysis - Inhibitors
Functional Analysis - Mimics
Localization Studies
qPCR Expression - SYBR
qPCR Expression - Probe

Country and Language

Explore dPCR & qPCR assay portfolio

Digital PCR Multiplex Assay Compatibility Checker

miRNA Mature hsa-miR-10392-5p

miRNA-Specific Assays for Results You Can Trust