GeneGlobe ID: DCG0000104 | Cat. No.: 250210 | dPCR CNV Probe Assays

dPCR CNV Probe Gene of Interest for KRAS

Gene symbol: KRAS
Ensembl Gene ID: ENSG00000133703
dPCR wet-lab validated

Select a variant to see the price

Product Specification

Product Name​
dPCR CNV Probe Gene of Interest for KRAS
GeneGlobe Cat.No. (Assay ID)​
DCG0000104
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
KRAS
Ensembl Gene ID​
ENSG00000133703
NCBI Gene Id​
3845
Strand​
Binds to forward (5’ to 3’) top genome strand
Amplicon length​
119
Amplicon region​
ATCTGCTTTCTGCCAAAATTAATGTGCTGAACTTAAACTTACCAGATTACATTATAATGCATTTTTTAATTTTCACACAGCCAGGAGTCTTTTCTTCTTTGCTGATTTTTTTCAATCTGTATTGTCGGATCTCTCTCACCAATGTATAA
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab validated​
dPCR wet-lab validated
Hydrolysis Probe​
FAM, ATTO 550, Cy5
Primer Purification​
Desalted
Probe Purification​
HPLC

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 228.57 KBLanguage: English

Resources

Application Notes (1)
Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.
Quick-Start Protocols (1)
Brochures & Guides (1)
For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR CNV Probe Gene of Interest for KRAS, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for KRAS facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for KRAS and elevate your work to new heights.