GeneGlobe ID: DMA00020 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Aeromonas hydrophila

Select a variant to see the price

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Aeromonas hydrophila
GeneGlobe Cat.No. (Assay ID)​
DMA00020
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Aeromonas hydrophila (644)
Aeromonas dourgesi
Aeromonas hydrophila (Chester 1901) Stanier 1943 (Approved Lists 1980)
Aeromonas liquefaciens
Bacillus hydrophilus fuscus
Bacterium hydrophilum
Proteus hydrophilus
Proteus ichthyosmius
Pseudomonas hydrophila
Template accession​
AF099022.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Aeromonas taiwanensis (633417)
Aeromonas media (651)
Aeromonas caviae (648)
Aeromonas dourgesi anaerogene
Aeromonas formicans
Aeromonas hydrophila anaerogenes
Aeromonas hydrophila subsp. anaerogenes
Aeromonas punctata subsp. caviae
Aeromonas punctata subsp. punctata
Aeromonas punctata
Bacillus punctatus
Pseudomonas caviae
Pseudomonas punctata
Aeromonas dhakensis (196024)
Aeromonas aquariorum
Aeromonas hydrophila subsp. dhakensis
Aeromonas veronii (654)
Aeromonas culicicola
Aeromonas hybridization group 10 (HG10)
Aeromonas ichthiosmia
Enteric Group 77
Aeromonas enteropelogenes (29489)
Aeromonas trota
Aeromonas tructi
Shewanella benthica (43661)
Aeromonas rivipollensis (948519)
Aeromonas rivipollensis Marti and Balcazar 2016
Application field​
Gastrointestinal Infections
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CACATGCAAGTCGAGCGGCAGCGGGAAAGTAGCTTGCTACTTTTGCCGGCGAGCGGCGGACGGGTGAGTAATGCCTGGGAAATTGCCCAGTCGAGGGGGATAACAGTTGGAAACGACTGCTAATACCGCATACGCCCTACG
Reaction size​
200rxns

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Aeromonas hydrophila, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Aeromonas caviae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Aeromonas hydrophila facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Aeromonas caviae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Aeromonas hydrophila and elevate your work to new heights.