GeneGlobe ID: DMA00047 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Phocaeicola dorei

Select a variant to see the price

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Alternative names of species: Bacteroides dorei
Product name​
Phocaeicola dorei
GeneGlobe Cat.No. (Assay ID)​
DMA00047
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Phocaeicola dorei (357276)
Bacteroides dorei Bakir et al. 2006
Phocaeicola dorei (Bakir et al. 2006) Garcia-Lopez et al. 2020
Template accession​
NZ_ABWZ01000093.1
Taxonomy​
Bacteria
Application field​
Human Microbiome
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
ATTTGACGTCATCCCCACCTTCCTCACATCTTACGATGGCAGTCTTGTCAGAGTCCTCAGCATCACCTGTTAGTAACTGACAACAAGGGTTGCGCTCGTTATGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTCACACTCGCTATTGCTAGCTGAACCGTTTCCGGATCATTCGAGTGCAATTTAAGCCCGGGTAAGGTTCC
Reaction size​
200rxns

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Phocaeicola dorei, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Phocaeicola dorei models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Phocaeicola dorei facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Phocaeicola dorei studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Phocaeicola dorei and elevate your work to new heights.