GeneGlobe ID: DMA00072 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Brevundimonas diminuta

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Brevundimonas diminuta
GeneGlobe Cat.No. (Assay ID)​
DMA00072
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Brevundimonas diminuta (293)
Bacterium parvulum
Pseudomonas diminuta
Template accession​
FJ658356.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Brevundimonas terrae (363631)
Brevundimonas naejangsanensis (588932)
Brevundimonas olei (657642)
Brevundimonas faecalis (947378)
Brevundimonas bullata (13160)
Mycoplana bullata
Application field​
Infectious Diseases
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GGGCGTAAAGGGCGCGTAGGCGGATCGTTAAGTCAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTGATACTGGCGATCTTGAGTATGAGAGAGGTATGTGGAACTCCGAGTGTAGAGGTGAAATTCGTAGATATTCGGAAGAACACCAGTGGCGAAGGCGACATACTGGCTCATTACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATTGCTAGTTGTCGGGCTGCATGCAGTTCGGTGACGCAGCTAACGCATTAAGCAATCCGCCTGGGGAGTACGGTCGCAAG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Brevundimonas diminuta, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Brevundimonas bullata models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Brevundimonas diminuta facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Brevundimonas bullata studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Brevundimonas diminuta and elevate your work to new heights.