GeneGlobe ID: DMA00123 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Coxiella burnetii

Select a variant to see the price

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Coxiella burnetii
GeneGlobe Cat.No. (Assay ID)​
DMA00123
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Coxiella burnetii (777)
Rickettsia burneti
Rickettsia diaporica
Template accession​
NC_002971.3
Taxonomy​
Bacteria
Application field​
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
ACACCAGTGGCGAAGGCGACTTCCTGGACCAATACTGACACTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGAGACCCTGGTAGTCCACGCCGTCAACGATGAGAACTAGCTGTTGGGAAGTTCACTTCTTAGTAGCGAAGCTAACGCGTTAAGTTCTCCGCCTGGGGAGTACGGCCGCA
Reaction size​
200rxns

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Coxiella burnetii, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Coxiella burnetii models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Coxiella burnetii facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Coxiella burnetii studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Coxiella burnetii and elevate your work to new heights.