Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name
Pseudomonas putida
GeneGlobe Cat.No. (Assay ID)
DMA00279
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Pseudomonas putida (303)
Arthrobacter siderocapsulatus
Bacillus fluorescens putidus
Bacillus putidus
Pseudomonas arvilla
Pseudomonas convexa
Pseudomonas eisenbergii
Pseudomonas incognita
Pseudomonas ovalis
Pseudomonas rugosa
Pseudomonas striata
Template accession
NC_010322.1
Secondary targets/specificity
Pseudomonas alcaligenes (43263)
Stutzerimonas stutzeri (316)
Achromobacter sewerinii
Achromobacter stutzeri
Bacillus denitrificans II
Bacillus nitrogenes
Bacillus stutzeri
Pseudomonas perfectomarina (ex ZoBell and Upham 1944) Baumann et al. 1983
Pseudomonas perfectomarina
Pseudomonas stutzeri (Lehmann and Neumann 1896) Sijderius 1946 (Approved Lists 1980)
Stutzerimonas perfectomarina
Pseudomonas mendocina (300)
Pseudomonas plecoglossicida (70775)
Pseudomonas entomophila (312306)
Pseudomonas nitroreducens (46680)
Pseudomonas azelaica
Application field
Biocontrol
Fermentation and Degradation
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GCTTATTCTGTCGGTAACGTCAAAACAGCAAGGTATTAACTTACTGCCCTTCCTCCCAACTTAAAGTGCTTTACAATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCAGGCTTTCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGACTGATCATCCTCTCAGACCAGTTACGGATCGTCGCCTTGGTGAGCCATTACCCCACCAACTAGCTAATCCGACCTAGGCTCATCTGATAGCGCAAGGCCCGAAGGTCCCCTGCTTTCTCCCGTAGGACGTATGCGGTATTAGCGTTCCTTTCGAAACGTTGTCCCCCACTACC