GeneGlobe ID: DMA00340 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Vibrio cholerae
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Vibrio cholerae
GeneGlobe Cat.No. (Assay ID)
DMA00340
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Vibrio cholerae (666)
Bacillo virgola del Koch
Bacillus cholerae-asiaticae
Bacillus cholerae
Kommabacillus
Liquidivibrio cholerae
Microspira comma
Pacinia cholerae-asiaticae
Spirillum cholerae-asiaticae
Spirillum cholerae
Vibrio albensis
Vibrio cholerae-asiaticae
Vibrio cholerae biovar albensis
Vibrio cholerae bv. albensis
Vibrio cholera
Vibrio comma
Bacillo virgola del Koch
Bacillus cholerae-asiaticae
Bacillus cholerae
Kommabacillus
Liquidivibrio cholerae
Microspira comma
Pacinia cholerae-asiaticae
Spirillum cholerae-asiaticae
Spirillum cholerae
Vibrio albensis
Vibrio cholerae-asiaticae
Vibrio cholerae biovar albensis
Vibrio cholerae bv. albensis
Vibrio cholera
Vibrio comma
Template accession
NC_002505.1
Taxonomy
Bacteria
Secondary targets/specificity
Vibrio mimicus (674)
Vibrio metoecus (1481663)
Vibrio metoecus (1481663)
Application field
Human Pathogens
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - TAMRA
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TTGCGAGGTTATGCGGTATTAGCCATCGTTTCCAATGGTTATCCCCCTCTACCGGGCAATTTCCCAGGCATTACTCACCCGTCCGCCGCTCGCCACCCAAGGAACAAGTTCCTCTGTGCTGCCGCTCGACTTGCATG
Reaction size
200rxns
Product Resources
File Size: 231.9 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Vibrio cholerae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Citrobacter amalonaticus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Vibrio cholerae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Citrobacter amalonaticus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Vibrio cholerae and elevate your work to new heights.