GeneGlobe ID: DMA00340 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Vibrio cholerae

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Vibrio cholerae
GeneGlobe Cat.No. (Assay ID)​
DMA00340
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Vibrio cholerae (666)
Bacillo virgola del Koch
Bacillus cholerae-asiaticae
Bacillus cholerae
Kommabacillus
Liquidivibrio cholerae
Microspira comma
Pacinia cholerae-asiaticae
Spirillum cholerae-asiaticae
Spirillum cholerae
Vibrio albensis
Vibrio cholerae-asiaticae
Vibrio cholerae biovar albensis
Vibrio cholerae bv. albensis
Vibrio cholera
Vibrio comma
Template accession​
NC_002505.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Vibrio mimicus (674)
Vibrio metoecus (1481663)
Application field​
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - TAMRA
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TTGCGAGGTTATGCGGTATTAGCCATCGTTTCCAATGGTTATCCCCCTCTACCGGGCAATTTCCCAGGCATTACTCACCCGTCCGCCGCTCGCCACCCAAGGAACAAGTTCCTCTGTGCTGCCGCTCGACTTGCATG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 231.9 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Vibrio cholerae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Citrobacter amalonaticus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Vibrio cholerae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Citrobacter amalonaticus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Vibrio cholerae and elevate your work to new heights.