GeneGlobe ID: DMA00360 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Salmonella spp. (1)
Product Specification
Bacterial detection assay targeting the Tetrathionate reductase subunit TtrC gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Salmonella spp. (1)
GeneGlobe Cat.No. (Assay ID)
DMA00360
Target type
Microbial Id
Target region
Tetrathionate reductase subunit TtrC
Target (NCBI taxonomy ID)
Salmonella enterica subsp. enterica (59201)
Salmonella cholerae-suis subsp. cholerae-suis
Salmonella choleraesuis subsp. choleraesuis
Salmonella enterica I
Salmonella enterica subsp. I
Salmonella enterica subsp. Subsp. I
Salmonella enterica subsp. Subsp. Ixxx
Salmonella cholerae-suis subsp. cholerae-suis
Salmonella choleraesuis subsp. choleraesuis
Salmonella enterica I
Salmonella enterica subsp. I
Salmonella enterica subsp. Subsp. I
Salmonella enterica subsp. Subsp. Ixxx
Template accession
CP005995.1
Taxonomy
Bacteria
Secondary targets/specificity
Salmonella (590)
Application field
Human Pathogens
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TCGCCACATCACGGTAGCTCAGACCAAAAGTGACCATCCCACCGACGGCGAGACCGACTTTTAGCCACTGACGACGGGTTAAATTAGCCATGTTGTAATCTCCTGGTGAGTCCGTTCAGCGTTTC
Reaction size
200rxns
Product Resources
File Size: 253.72 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Salmonella spp. (1), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Salmonella models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Salmonella spp. (1) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Salmonella studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Salmonella spp. (1) and elevate your work to new heights.