GeneGlobe ID: DMA00360 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Salmonella spp. (1)

Select a variant to see the price

Product Specification

Bacterial detection assay targeting the Tetrathionate reductase subunit TtrC gene
dPCR wet-lab validated
Product name​
Salmonella spp. (1)
GeneGlobe Cat.No. (Assay ID)​
DMA00360
Target type​
Microbial Id
Target region​
Tetrathionate reductase subunit TtrC
Target (NCBI taxonomy ID)​
Salmonella enterica subsp. enterica (59201)
Salmonella cholerae-suis subsp. cholerae-suis
Salmonella choleraesuis subsp. choleraesuis
Salmonella enterica I
Salmonella enterica subsp. I
Salmonella enterica subsp. Subsp. I
Salmonella enterica subsp. Subsp. Ixxx
Template accession​
CP005995.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Salmonella (590)
Application field​
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TCGCCACATCACGGTAGCTCAGACCAAAAGTGACCATCCCACCGACGGCGAGACCGACTTTTAGCCACTGACGACGGGTTAAATTAGCCATGTTGTAATCTCCTGGTGAGTCCGTTCAGCGTTTC
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 256.26 KBLanguage: English

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Salmonella spp. (1), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Salmonella models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Salmonella spp. (1) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Salmonella studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Salmonella spp. (1) and elevate your work to new heights.