dPCR Microbial DNA Detection Assay for Pectinatus cerevisiiphilus

GeneGlobe ID: DMA00387 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the flagellin (flaA) gene
Product name​
Pectinatus cerevisiiphilus
GeneGlobe Cat.No. (Assay ID)​
DMA00387
Target type​
Microbial Id
Target region​
Flagellin (flaA) gene
Target (NCBI taxonomy ID)​
Pectinatus cerevisiiphilus (86956)
Template accession​
AY659940.1
Taxonomy​
Bacteria
Application field​
Food Production
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TTTTGGCAATACTTTTGCCGACAGCCAAATTGGTACAACTGCTGAAGGTCTAATGATGCATACTGCAGACGGTACATCAGTATTAGCTATTTCTTCCAGTGCATCAGGGGTTGGTGGCAATATTGCTGGTTTTACTATCAGCATCACTGGTACTGACGGTAATGTCAAAAAATCTGTAAATTCTAAGCTTGATGCGTGGAGTGAACAGATTAGCGCCCAG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Pectinatus cerevisiiphilus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Pectinatus cerevisiiphilus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Pectinatus cerevisiiphilus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Pectinatus cerevisiiphilus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Pectinatus cerevisiiphilus and elevate your work to new heights.