GeneGlobe ID: DMA00449 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Enterobacter cloacae (2)
Product Specification
Bacterial detection assay targeting the outer membrane porin C (ompC) gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Enterobacter cloacae (2)
GeneGlobe Cat.No. (Assay ID)
DMA00449
Target type
Microbial Id
Target region
Outer membrane porin C (ompC) gene
Target (NCBI taxonomy ID)
Enterobacter cloacae (550)
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Template accession
CP002886.1
Taxonomy
Bacteria
Secondary targets/specificity
Citrobacter amalonaticus (35703)
Citrobacter intermedius biogroup a
Levinea amalonatica
Enterobacter asburiae (61645)
CDC Enteric Group 17
Enterobacter muelleri
Enterobacter ludwigii (299767)
Enterobacter sp. E20 (1560339)
Citrobacter intermedius biogroup a
Levinea amalonatica
Enterobacter asburiae (61645)
CDC Enteric Group 17
Enterobacter muelleri
Enterobacter ludwigii (299767)
Enterobacter sp. E20 (1560339)
Application field
Infectious Diseases
Wastewater & Drinking Water Epidemiology
Multiple Drug Resistance
Wastewater & Drinking Water Epidemiology
Multiple Drug Resistance
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TGCCGTACAGATCTAATTTGTTGCCATCTTTGTTATAAATTTCAGCCGCATTTGCTGCGCCTGCCACCAGCAGAGCTGGTACCAGGAGGGACAGTACTTTAACTTTCATTTTATTAACCCTCTGTTATATGCCTTATAATTGCCACTGC
Reaction size
200rxns
Product Resources
File Size: 232.87 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Enterobacter cloacae (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Citrobacter amalonaticus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Enterobacter cloacae (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Citrobacter amalonaticus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Enterobacter cloacae (2) and elevate your work to new heights.