GeneGlobe ID: DMA00449 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Enterobacter cloacae (2)

Product Specification

Bacterial detection assay targeting the outer membrane porin C (ompC) gene
dPCR wet-lab validated
Product name​
Enterobacter cloacae (2)
GeneGlobe Cat.No. (Assay ID)​
DMA00449
Target type​
Microbial Id
Target region​
Outer membrane porin C (ompC) gene
Target (NCBI taxonomy ID)​
Enterobacter cloacae (550)
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Template accession​
CP002886.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Citrobacter amalonaticus (35703)
Citrobacter intermedius biogroup a
Levinea amalonatica
Enterobacter asburiae (61645)
CDC Enteric Group 17
Enterobacter muelleri
Enterobacter ludwigii (299767)
Enterobacter sp. E20 (1560339)
Application field​
Infectious Diseases
Wastewater & Drinking Water Epidemiology
Multiple Drug Resistance
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TGCCGTACAGATCTAATTTGTTGCCATCTTTGTTATAAATTTCAGCCGCATTTGCTGCGCCTGCCACCAGCAGAGCTGGTACCAGGAGGGACAGTACTTTAACTTTCATTTTATTAACCCTCTGTTATATGCCTTATAATTGCCACTGC
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 232.87 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Enterobacter cloacae (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Citrobacter amalonaticus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Enterobacter cloacae (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Citrobacter amalonaticus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Enterobacter cloacae (2) and elevate your work to new heights.