GeneGlobe ID: DMA00481 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Alternaria alternata

Select a variant to see the price

Product Specification

Fungal detection assay targeting the mating type protein MAT1-2 gene
Product name​
Alternaria alternata
GeneGlobe Cat.No. (Assay ID)​
DMA00481
Target type​
Microbial Id
Target region​
Mating type protein MAT1-2 gene
Target (NCBI taxonomy ID)​
Alternaria alternata (5599)
Alternaria tenuis
Torula alternata
Template accession​
KY559285.1
Taxonomy​
Plants and Fungi
Secondary targets/specificity​
Alternaria tangelonis (232506)
Alternaria allii-tuberosi (1132459)
Ulocladium allii-tuberosi
Alternaria arborescens (156630)
Alternaria tenuissima (119927)
Helminthosporium tenuissimum
Alternaria citriarbusti (232505)
Application field​
Environmental Microbes
Infectious Diseases
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
No
Region of Interest​
CCTTGCTCAGCTCTTCGAGCCGGCAAACGTATTTGATATGTTCGCCCAAGACTCAACATCTGCGGACTTCACCTACGACTCAGAGTCTTTCCGTCACGGTCGCCTTGACGAGGAGTTCGGCATGGATTTCGACATGAACGCAAATTTTGCGCTGCTTGATGATGAGGCTTTTGCCTT
Reaction size​
200rxns

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Alternaria alternata, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Alternaria allii-tuberosi models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Alternaria alternata facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Alternaria allii-tuberosi studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Alternaria alternata and elevate your work to new heights.