GeneGlobe ID: DMA00718 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Brettanomyces bruxellensis

Product Specification

Fungal detection assay targeting the ITS1 and 5.8S ribosomal RNA gene
Alternative names of species: B. bruxellensis
dPCR wet-lab validated
Product name​
Brettanomyces bruxellensis
GeneGlobe Cat.No. (Assay ID)​
DMA00718
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
Brettanomyces bruxellensis (5007)
Brettanomyces custersii
Dekkera bruxellensis
Dekkera intermedia
Template accession​
KT764072.1
Taxonomy​
Plants and Fungi
Application field​
Plant Pathogens / Food Spoilage
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
GCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 101.24 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Brettanomyces bruxellensis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Brettanomyces bruxellensis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Brettanomyces bruxellensis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Brettanomyces bruxellensis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Brettanomyces bruxellensis and elevate your work to new heights.