dPCR Microbial DNA Detection Assay for Dengue virus 1
GeneGlobe ID: DMA00731 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Viral detection assay
Alternative names of species: Dengue Virus serotype 1, dengue type 1 D1 virus
dPCR wet-lab validated
Alternative names of species: Dengue Virus serotype 1, dengue type 1 D1 virus
dPCR wet-lab validated
Product name
Dengue virus 1
GeneGlobe Cat.No. (Assay ID)
DMA00731
Target type
Microbial Id
Target (NCBI taxonomy ID)
dengue virus type 1 (11053)
dengue type 1 D1 virus
dengue virus-1 DEN-1
Dengue virus 1
dengue virus type 1 DEN1
dengue virus type I
type 1 dengue virus DEN-1
dengue type 1 D1 virus
dengue virus-1 DEN-1
Dengue virus 1
dengue virus type 1 DEN1
dengue virus type I
type 1 dengue virus DEN-1
Template accession
MN018297.1
Taxonomy
Viruses
Application field
Tropical & Vector-borne Diseases
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
AGACGGGTCGACCGTCTTTCAATATGCTGAAACGCGCGAGAAACCGCGTGTCAACTGTTTCACAGTTGGCGAAGAGATTCTCAAAAGGATTGCTTTCAGGCCAAGGACCCATGAAATTGGTGATGGCTTTTATA
Reaction size
200rxns
Product Resources
File Size: 113.51 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Dengue virus 1, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with dengue virus type 1 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Dengue virus 1 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for dengue virus type 1 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Dengue virus 1 and elevate your work to new heights.