Viral detection assay
Alternative names of species: Dengue Virus serotype 1, dengue type 1 D1 virus
dPCR wet-lab verified
Product name
Dengue virus 1
GeneGlobe Cat.No. (Assay ID)
DMA00731
Target (NCBI taxonomy ID)
dengue virus type 1 (11053)
dengue type 1 D1 virus
dengue virus-1 DEN-1
Dengue virus 1
dengue virus type 1 DEN1
dengue virus type I
type 1 dengue virus DEN-1
Template accession
MN018297.1
Application field
Tropical & Vector-borne Diseases
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
AGACGGGTCGACCGTCTTTCAATATGCTGAAACGCGCGAGAAACCGCGTGTCAACTGTTTCACAGTTGGCGAAGAGATTCTCAAAAGGATTGCTTTCAGGCCAAGGACCCATGAAATTGGTGATGGCTTTTATA