dPCR Microbial DNA Detection Assay for Dengue virus 1

GeneGlobe ID: DMA00731 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: Dengue Virus serotype 1, dengue type 1 D1 virus
dPCR wet-lab verified
Product name​
Dengue virus 1
GeneGlobe Cat.No. (Assay ID)​
DMA00731
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
dengue virus type 1 (11053)
dengue type 1 D1 virus
dengue virus-1 DEN-1
Dengue virus 1
dengue virus type 1 DEN1
dengue virus type I
type 1 dengue virus DEN-1
Template accession​
MN018297.1
Taxonomy​
Viruses
Application field​
Tropical & Vector-borne Diseases
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
AGACGGGTCGACCGTCTTTCAATATGCTGAAACGCGCGAGAAACCGCGTGTCAACTGTTTCACAGTTGGCGAAGAGATTCTCAAAAGGATTGCTTTCAGGCCAAGGACCCATGAAATTGGTGATGGCTTTTATA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 113.51 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Dengue virus 1, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with dengue virus type 1 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Dengue virus 1 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for dengue virus type 1 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Dengue virus 1 and elevate your work to new heights.