GeneGlobe ID: DMA00750 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Hepatitis E virus

Select a variant to see the price

Product Specification

Viral detection assay
Alternative names of species: HEV
dPCR wet-lab validated
Product name​
Hepatitis E virus
GeneGlobe Cat.No. (Assay ID)​
DMA00750
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
Hepatitis E virus (291484)
Hepatitis E virus HEV
Template accession​
JN564006.1
Taxonomy​
Viruses
Application field​
Wastewater and drinking water epidemiology
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Template present in Microbial DNA Positive Control​
No
Region of Interest​
AGCGGCGGTGCCGGCGGTGGTTTCTGGGGTGACAGGGTTGATTCTCAGCCCTTCGCCCTCCCCTATATTCATCCAACCAACCCCTTCGCCGCCGATGTCG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 83.96 KBLanguage: English

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Hepatitis E virus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Hepatitis E virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Hepatitis E virus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Hepatitis E virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Hepatitis E virus and elevate your work to new heights.