GeneGlobe ID: DMA00765 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Alicyclobacillus acidoterrestris

Product Specification

Bacterial detection assay
Alternative names of species: Bacillus acidoterrestris Deinhard et al. 1988
dPCR wet-lab validated
Product name​
Alicyclobacillus acidoterrestris
GeneGlobe Cat.No. (Assay ID)​
DMA00765
Target type​
Microbial Id
Target region​
vdc (vanillate decarboxylase)
Target (NCBI taxonomy ID)​
Alicyclobacillus acidoterrestris (1450)
Bacillus acidoterrestris
Template accession​
KX453674.1
Taxonomy​
Bacteria
Application field​
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
CAATGAAGGAAGGTGGGAGATCCGTGAAAATTATTGTCGGTATTACAGGTGCCACCGGTGCGATATTCGGAATTCGACTGCTCGAATTACTCAACGCCGCAGGTGTGGAAACACATCTCGTGGT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 88.2 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Alicyclobacillus acidoterrestris, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Alicyclobacillus acidoterrestris models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Alicyclobacillus acidoterrestris facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Alicyclobacillus acidoterrestris studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Alicyclobacillus acidoterrestris and elevate your work to new heights.