GeneGlobe ID: DMA00765 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Alicyclobacillus acidoterrestris
Product Specification
Bacterial detection assay
Alternative names of species: Bacillus acidoterrestris Deinhard et al. 1988
dPCR wet-lab validated
Alternative names of species: Bacillus acidoterrestris Deinhard et al. 1988
dPCR wet-lab validated
Product name
Alicyclobacillus acidoterrestris
GeneGlobe Cat.No. (Assay ID)
DMA00765
Target type
Microbial Id
Target region
vdc (vanillate decarboxylase)
Target (NCBI taxonomy ID)
Alicyclobacillus acidoterrestris (1450)
Bacillus acidoterrestris
Bacillus acidoterrestris
Template accession
KX453674.1
Taxonomy
Bacteria
Application field
Food Production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
CAATGAAGGAAGGTGGGAGATCCGTGAAAATTATTGTCGGTATTACAGGTGCCACCGGTGCGATATTCGGAATTCGACTGCTCGAATTACTCAACGCCGCAGGTGTGGAAACACATCTCGTGGT
Reaction size
200rxns
Product Resources
File Size: 88.2 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Alicyclobacillus acidoterrestris, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Alicyclobacillus acidoterrestris models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Alicyclobacillus acidoterrestris facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Alicyclobacillus acidoterrestris studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Alicyclobacillus acidoterrestris and elevate your work to new heights.