GeneGlobe ID: DMA00878 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Zygosaccharomyces rouxii
Product Specification
Yeast detection assay
Alternative names of species: Saccharomyces rouxii
dPCR wet-lab validated
Alternative names of species: Saccharomyces rouxii
dPCR wet-lab validated
Product name
Zygosaccharomyces rouxii
GeneGlobe Cat.No. (Assay ID)
DMA00878
Target type
Microbial Id
Target region
Golgi transport complex subunit COG6
Target (NCBI taxonomy ID)
Zygosaccharomyces rouxii (4956)
Saccharomyces rouxii
Saccharomyces rouxii
Template accession
CU928176.1
Taxonomy
Plants and Fungi
Application field
Food Testing
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
AAAATTCGTTAAAATGTTCTAAATCATTGGAAAGGTAGATTAAACTCTTTTGAAATAATATGAAATTTTTATCATCAGGATCGAATGATCTTTCACCTAGAAGTTGAGAATTGGATTCATAATTGTGTAAAAAATCAACTAAATGGTTGAAAACTTTTTTATTGACAAAGCTTAGCGTTTGATTTGTTTGGGAAATT
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Zygosaccharomyces rouxii, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Zygosaccharomyces rouxii models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Zygosaccharomyces rouxii facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Zygosaccharomyces rouxii studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Zygosaccharomyces rouxii and elevate your work to new heights.