dPCR Microbial DNA Detection Assay for Human Papillomavirus 11

GeneGlobe ID: DMA00881 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: Human papillomavirus type 11, HPV11, HPV-11, Human papillomavirus-11
dPCR wet-lab validated
Product name​
Human Papillomavirus 11
GeneGlobe Cat.No. (Assay ID)​
DMA00881
Target type​
Microbial Id
Target region​
L1
Target (NCBI taxonomy ID)​
human papillomavirus 11 (10580)
HPV 11
HPV-11
Human papillomavirus - 11
Human papillomavirus type 11
HPV11
Template accession​
FR872717.1
Taxonomy​
Viruses
Application field​
Human Pathogens
Infectious Diseases
Sexually Transmitted Infections (STI)
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TATTGGCTTCAAAAGGCTCAGGGACATAACAATGGTATTTGCTGGGGAAACCACTTGTTTGTTACTGTGGTAGATACCACACGCAGTACAAATATGA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human Papillomavirus 11, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with human papillomavirus 11 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human Papillomavirus 11 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for human papillomavirus 11 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human Papillomavirus 11 and elevate your work to new heights.