GeneGlobe ID: DMA00881 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Human Papillomavirus 11
Product Specification
Viral detection assay
Alternative names of species: Human papillomavirus type 11, HPV11, HPV-11, Human papillomavirus-11
dPCR wet-lab validated
Alternative names of species: Human papillomavirus type 11, HPV11, HPV-11, Human papillomavirus-11
dPCR wet-lab validated
Product name
Human Papillomavirus 11
GeneGlobe Cat.No. (Assay ID)
DMA00881
Target type
Microbial Id
Target region
L1
Target (NCBI taxonomy ID)
human papillomavirus 11 (10580)
HPV 11
HPV-11
Human papillomavirus - 11
Human papillomavirus type 11
HPV11
HPV 11
HPV-11
Human papillomavirus - 11
Human papillomavirus type 11
HPV11
Template accession
FR872717.1
Taxonomy
Viruses
Application field
Human Pathogens
Infectious Diseases
Sexually Transmitted Infections (STI)
Infectious Diseases
Sexually Transmitted Infections (STI)
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TATTGGCTTCAAAAGGCTCAGGGACATAACAATGGTATTTGCTGGGGAAACCACTTGTTTGTTACTGTGGTAGATACCACACGCAGTACAAATATGA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human Papillomavirus 11, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with human papillomavirus 11 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human Papillomavirus 11 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for human papillomavirus 11 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human Papillomavirus 11 and elevate your work to new heights.