GeneGlobe ID: DMA00892 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Influenza A virus (Q226L-wildtype)
Product Specification
Viral detection assay
Alternative names of species: H5N1
dPCR wet-lab validated
Alternative names of species: H5N1
dPCR wet-lab validated
Product name
Influenza A virus (Q226L-wildtype)
GeneGlobe Cat.No. (Assay ID)
DMA00892
Target type
Microbial Id
Target region
H5
Target (NCBI taxonomy ID)
H5N1 subtype (102793)
H5N1
H5N1
Template accession
PQ493719.1
Taxonomy
Viruses
Application field
Human Pathogens
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TCATTCCAACAATGCAGAAGAGCAGACAAATCTCTACAAAAACCCAATCACCTACATTTCAGTTGGAACATCAACTTTAAACCAGAGGTTAGCACCAAAAATAGCTACTAGATCCCAAGTAAACGGGCAACGTGGAAGAATGGACTTCTTCTGGACAATCTTAAAACCAGATGATGCAATCCATTTCGAGAGTAACGGAAATTTCAT
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Influenza A virus (Q226L-wildtype), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with H5N1 subtype models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Influenza A virus (Q226L-wildtype) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for H5N1 subtype studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Influenza A virus (Q226L-wildtype) and elevate your work to new heights.