dPCR Microbial DNA Detection Assay for Erwinia amylovora

GeneGlobe ID: DMA00903 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay
Alternative names of species: Micrococcus amylovorus, Bacillus amylovorus, Bacterium amylovorus
dPCR wet-lab validated
Product name​
Erwinia amylovora
GeneGlobe Cat.No. (Assay ID)​
DMA00903
Target type​
Microbial Id
Target region​
16s rRNA
Target (NCBI taxonomy ID)​
Erwinia amylovora (552)
Bacillus amylovorus
Bacterium amylovorus
Micrococcus amylovorus
Template accession​
AJ233410.1
Taxonomy​
Bacteria
Application field​
Plant Pathogens / Food Spoilage
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
CCTTACCTGGCCTTGACATCCACGGAATTCTGCAGAGATGCGGAAGTGCCTTCGGGAACCGTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTATCCTTTGTTGCCAGCGATTCGGTCGGGAACTCAAAGGAGACTGCCGG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Erwinia amylovora, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Erwinia amylovora models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Erwinia amylovora facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Erwinia amylovora studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Erwinia amylovora and elevate your work to new heights.