GeneGlobe ID: DMA00903 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Erwinia amylovora
Product Specification
Bacterial detection assay
Alternative names of species: Micrococcus amylovorus, Bacillus amylovorus, Bacterium amylovorus
dPCR wet-lab validated
Alternative names of species: Micrococcus amylovorus, Bacillus amylovorus, Bacterium amylovorus
dPCR wet-lab validated
Product name
Erwinia amylovora
GeneGlobe Cat.No. (Assay ID)
DMA00903
Target type
Microbial Id
Target region
16s rRNA
Target (NCBI taxonomy ID)
Erwinia amylovora (552)
Bacillus amylovorus
Bacterium amylovorus
Micrococcus amylovorus
Bacillus amylovorus
Bacterium amylovorus
Micrococcus amylovorus
Template accession
AJ233410.1
Taxonomy
Bacteria
Application field
Plant Pathogens / Food Spoilage
Food Production
Food Production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
CCTTACCTGGCCTTGACATCCACGGAATTCTGCAGAGATGCGGAAGTGCCTTCGGGAACCGTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTATCCTTTGTTGCCAGCGATTCGGTCGGGAACTCAAAGGAGACTGCCGG
Reaction size
200rxns
Resources
Available Product Catalog (2)
Protocoles de démarrage rapide (1)
Notes d’application (2)
Informations techniques (1)
Manuels de kit (1)
Affiches scientifiques (1)
Brochures et guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Erwinia amylovora, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Erwinia amylovora models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Erwinia amylovora facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Erwinia amylovora studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Erwinia amylovora and elevate your work to new heights.