GeneGlobe ID: DMA00911 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Zymoseptoria tritici
Product Specification
Yeast detection assay
Alternative names of species: Septoria tritici
dPCR wet-lab validated
Alternative names of species: Septoria tritici
dPCR wet-lab validated
Product name
Zymoseptoria tritici
GeneGlobe Cat.No. (Assay ID)
DMA00911
Target type
Microbial Id
Target region
ITS2
Target (NCBI taxonomy ID)
Zymoseptoria tritici (1047171)
Mycosphaerella graminicola
Septoria tritici
Sphaeria graminicola
Mycosphaerella graminicola
Septoria tritici
Sphaeria graminicola
Template accession
NR_158992.1
Taxonomy
Plants and Fungi
Application field
Plant Pathogens / Food Spoilage
Food Production
Food Production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
CAGCCTCGCTGGGTATTGGGCGTCTTTTCGCGGGGGATCACTCCCCCGCGCGCCTCAAAGTCTCCGGCTGAGCGGTCTCGTCTCCCAGCGTTGTGGCATCACGTCTCGCCGCGGAGTTCACGAGCCCTCACGGCCGTTAAATCACACCTCAGGTTGACCTCGGATCGGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Zymoseptoria tritici, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Zymoseptoria tritici models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Zymoseptoria tritici facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Zymoseptoria tritici studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Zymoseptoria tritici and elevate your work to new heights.