dPCR Microbial DNA Detection Assay for Betapolyomavirus macacae
GeneGlobe ID: DMA00936 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Viral detection assay
Alternative names of species: SV40, Macaca mulatta polyomavirus 1, Polyomavirus maccacae, Polyomavirus maccacae 1, Rhesus macaque polyomavirus, Simian virus 40, Rhesus polyomavirus
dPCR wet-lab verified
Alternative names of species: SV40, Macaca mulatta polyomavirus 1, Polyomavirus maccacae, Polyomavirus maccacae 1, Rhesus macaque polyomavirus, Simian virus 40, Rhesus polyomavirus
dPCR wet-lab verified
Product name
Betapolyomavirus macacae
GeneGlobe Cat.No. (Assay ID)
DMA00936
Target type
Microbial Id
Target region
large T Antigene; HEK293T
Target (NCBI taxonomy ID)
Betapolyomavirus macacae (1891767)
Macaca mulatta polyomavirus 1
Polyomavirus maccacae 1
Polyomavirus maccacae
Rhesus macaque polyomavirus
rhesus polyomavirus
Simian virus 40
SV40
sv-40
Macaca mulatta polyomavirus 1
Polyomavirus maccacae 1
Polyomavirus maccacae
Rhesus macaque polyomavirus
rhesus polyomavirus
Simian virus 40
SV40
sv-40
Template accession
NC_001669.1
Taxonomy
Viruses
Application field
Adventitious Agents
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
CTCATCATCACTAGATGGCATTTCTTCTGAGCAAAACAGGTTTTCCTCATTAAAGGCATTCCACCACTGCTCCCATTCATCAGTTCCATAGGTTGGAATCTAAAATACACAAA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Brochures and Guides (2)
Kit Handbooks (1)
Protocols (3)
Scientific Posters (1)
Technical Information (1)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Betapolyomavirus macacae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Betapolyomavirus macacae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Betapolyomavirus macacae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Betapolyomavirus macacae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Betapolyomavirus macacae and elevate your work to new heights.