dPCR Microbial DNA Detection Assay for HAdV-5 in HEK293
GeneGlobe ID: DMA00938 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Viral detection assay targeting Adenovirus early region 1A (E1A)
Alternative names of species: Human adenovirus 5, Adenovirus 5, Adenovirus type 5, Human adenovirus C5, Human adenovirus type 5, Human mastadenovirus 5, Mastadenovirus 5, Mastadenovirus h5, adenovirus Ad5, adenovirus type 5 AD5
dPCR wet-lab verified
Alternative names of species: Human adenovirus 5, Adenovirus 5, Adenovirus type 5, Human adenovirus C5, Human adenovirus type 5, Human mastadenovirus 5, Mastadenovirus 5, Mastadenovirus h5, adenovirus Ad5, adenovirus type 5 AD5
dPCR wet-lab verified
Product name
HAdV-5 in HEK293
GeneGlobe Cat.No. (Assay ID)
DMA00938
Target type
Microbial Id
Target region
Early region E1A
Target (NCBI taxonomy ID)
Human adenovirus 5 (28285)
Adenovirus 5
adenovirus Ad5
adenovirus type 5 AD5
Adenovirus type 5
Human adenovirus C5
Human adenovirus type 5
Human mastadenovirus 5
Mastadenovirus 5
Mastadenovirus h5
Adenovirus 5
adenovirus Ad5
adenovirus type 5 AD5
Adenovirus type 5
Human adenovirus C5
Human adenovirus type 5
Human mastadenovirus 5
Mastadenovirus 5
Mastadenovirus h5
Template accession
OQ518274.1
Taxonomy
Viruses
Application field
Adventitious Agents
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
GTGGTTTAAAGAATTTTGTATTGTGATTTTTTTAAAAGGTCCTGTGTCTGAACCTGAGCCTGAGCCCGAGCCAGAACCGGAACCTGCAAGACCTACCCGACGTCCTAAAATGGTGCCTGCTATCCTGAGACGCCCGACATCACCTGTGTCCA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for HAdV-5 in HEK293, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Human adenovirus 5 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for HAdV-5 in HEK293 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Human adenovirus 5 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for HAdV-5 in HEK293 and elevate your work to new heights.