dPCR Microbial DNA Detection Assay for HAdV-5 in HEK293

GeneGlobe ID: DMA00938 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay targeting Adenovirus early region 1A (E1A)
Alternative names of species: Human adenovirus 5, Adenovirus 5, Adenovirus type 5, Human adenovirus C5, Human adenovirus type 5, Human mastadenovirus 5, Mastadenovirus 5, Mastadenovirus h5, adenovirus Ad5, adenovirus type 5 AD5
dPCR wet-lab verified
Product name​
HAdV-5 in HEK293
GeneGlobe Cat.No. (Assay ID)​
DMA00938
Target type​
Microbial Id
Target region​
Early region E1A
Target (NCBI taxonomy ID)​
Human adenovirus 5 (28285)
Adenovirus 5
adenovirus Ad5
adenovirus type 5 AD5
Adenovirus type 5
Human adenovirus C5
Human adenovirus type 5
Human mastadenovirus 5
Mastadenovirus 5
Mastadenovirus h5
Template accession​
OQ518274.1
Taxonomy​
Viruses
Application field​
Adventitious Agents
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
GTGGTTTAAAGAATTTTGTATTGTGATTTTTTTAAAAGGTCCTGTGTCTGAACCTGAGCCTGAGCCCGAGCCAGAACCGGAACCTGCAAGACCTACCCGACGTCCTAAAATGGTGCCTGCTATCCTGAGACGCCCGACATCACCTGTGTCCA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for HAdV-5 in HEK293, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Human adenovirus 5 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for HAdV-5 in HEK293 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Human adenovirus 5 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for HAdV-5 in HEK293 and elevate your work to new heights.