dPCR Microbial DNA Detection Assay for Minute Virus of Mice
GeneGlobe ID: DMA00942 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Viral detection assay
Alternative names of species: Minute Virus of Mice Cutter strain, Murine minute virus, murine parvovirus, Mice minute virus, Minute virus of mouse, Mouse minute virus
dPCR wet-lab validated
Alternative names of species: Minute Virus of Mice Cutter strain, Murine minute virus, murine parvovirus, Mice minute virus, Minute virus of mouse, Mouse minute virus
dPCR wet-lab validated
Product name
Minute Virus of Mice
GeneGlobe Cat.No. (Assay ID)
DMA00942
Target type
Microbial Id
Target region
NS1
Target (NCBI taxonomy ID)
Minute virus of mice (10794)
Mice minute virus
Minute Virus of Mice Cutter strain
Murine minute virus
murine parvovirus
MVM
Mice minute virus
Minute Virus of Mice Cutter strain
Murine minute virus
murine parvovirus
MVM
Template accession
NC_001510
Taxonomy
Viruses
Application field
Adventitious Agents
Positive Control Assay
Positive Control Assay
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
CviQI, HaeIII, EcoRI, XbaI
Template present in Microbial DNA Positive Control
No
Region of Interest
CTGGCACTGCCATGTACTAATTGGAGGAAAGGACTTTAGTCAAGCTCAAGGGAAATGGTGGAGAAGGCAACTAAATGTTTACTGGAGCAGATGGTTGGTAACAGCCTGTAATGTGCAACTAACACCAGCTGAAAGAATTAAACTAAGAGAAATAGC
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Minute Virus of Mice, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Minute virus of mice models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Minute Virus of Mice facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Minute virus of mice studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Minute Virus of Mice and elevate your work to new heights.