dPCR Microbial DNA Detection Assay for Mammalian orthorubulavirus 5

GeneGlobe ID: DMA00952 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: Simian virus 5, SV5
dPCR wet-lab verified
Product name​
Mammalian orthorubulavirus 5
GeneGlobe Cat.No. (Assay ID)​
DMA00952
Target type​
Microbial Id
Target region​
nucleocapsid protein NP
Target (NCBI taxonomy ID)​
Mammalian orthorubulavirus 5 (2560580)
Mammalian rubulavirus 5
Simian parainfluenza virus 5
simian paramyxovirus SV5
Simian paramyxovirus (SV5)
Simian virus 5
simian virus 5 SV5
SV-5
SV5
Template accession​
PQ881840.1
Taxonomy​
Viruses
Application field​
Adventitious Agents
Infectious Diseases
Human Pathogens
Animal Disease
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
CviQI, EcoRI, XbaI, PvuII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TGGAATGGGAGGCTTCTTTTTGACACTAAAATATGCATTAGGAACCAGATGGCCCACACTTGCTTTAGCTGCATTTTCAGGAGAGCTAACAAAGCTAAAGTCCCTCATGGCATTATACCAGACCCTTGGTGAGCAGGCCCGATATTTGGCCCTATTGGAGTCACCACATTTGATGGATTTTGCTGCA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Mammalian orthorubulavirus 5, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Mammalian orthorubulavirus 5 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Mammalian orthorubulavirus 5 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Mammalian orthorubulavirus 5 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Mammalian orthorubulavirus 5 and elevate your work to new heights.