dPCR Microbial DNA Detection Assay for Pediococcus

GeneGlobe ID: DMA00955 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay
dPCR wet-lab validated
Product name​
Pediococcus
GeneGlobe Cat.No. (Assay ID)​
DMA00955
Target type​
Microbial Id
Target region​
23S rRNA gene
Target (NCBI taxonomy ID)​
Pediococcus (1253)
Template accession​
 EF397604.1
Taxonomy​
Bacteria
Application field​
Probiotics
Food Production
Fermentation and Degradation
Plant Pathogens / Food Spoilage
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
AluI, EcoRI, XbaI, PvuII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
CCGAAAATGTACCGGGGCTTAAACATATTACCGAGACTGTGGATGCCACCATTAGGTGGCGTGATAGGAGAGCGTTCTAAGGGCGATGAAGGCAGACCGTGAGGACTGTTGGAGCGCTTAGAAGTGAGAATGCCGGTATGAGTAGCGAAAGATAGGTGAGAATCCTATCCACCGTATGACTAAGGTTTCCTGGGGAAGGCTCGTCCTCCCAGGGTTAGTCGGGACCTAAGCCGAGGCCGAGAGGCGTAGGCGATGGATAACAGGTTGATATTCCTGTACTAGTTAAACTTGTTTGAACAATGGAGGGACGCAGTAGGCTAA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Pediococcus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Pediococcus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Pediococcus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Pediococcus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Pediococcus and elevate your work to new heights.