dPCR Microbial DNA Detection Assay for aggR
GeneGlobe ID: DMA00960 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Virulence Gene detection assay
dPCR wet-lab validated
dPCR wet-lab validated
Product name
aggR
GeneGlobe Cat.No. (Assay ID)
DMA00960
Target type
Virulence
Target region
aggR
Target (NCBI taxonomy ID)
aggr
Template accession
CU928159.2
Taxonomy
Virulence Genes
Application field
Microbial Virulence
Foodborne Pathogens
Gastrointestinal Infections
Human Pathogens
Infectious Diseases
Foodborne Pathogens
Gastrointestinal Infections
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
CviQI, HaeIII, EcoRI, XbaI, PvuII
Template present in Microbial DNA Positive Control
No
Region of Interest
CGATACATTAAGACGCCTAAAGGATGCCCTGATGATAATATACGGAATATCAAAAGTAGATGCTTGCAGTTGTCCGAATTGGTCAAAAGGAATAATTGTAGCTGATGCTGACGATTCTGTATTAGATACATT
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for aggR, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with aggr models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for aggR facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for aggr studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for aggR and elevate your work to new heights.