dPCR Microbial DNA Detection Assay for Shigella

GeneGlobe ID: DMA00978 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay
dPCR wet-lab validated
Product name​
Shigella
GeneGlobe Cat.No. (Assay ID)​
DMA00978
Target type​
Microbial Id
Target region​
ipaH
Target (NCBI taxonomy ID)​
Shigella (620)
Template accession​
CP162060.1
Taxonomy​
Bacteria
Application field​
Food Production
Foodborne Pathogens
Food Testing
Gastrointestinal Infections
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
HaeIII, EcoRI, XbaI, PvuII
Template present in Microbial DNA Positive Control​
No
Additional assay information​
Assay based on proven sequences of mericon qPCR system
Region of Interest​
TCACCGCTCAGACCTGATGCTTTCAGCCGGTCAGCCACCCTCTGAGAGTACTCATTCTCCAGCATCTCATACTTCTGCTCTTCTGCCTGCGCCCAGCGGTCAGCTTCCGTACGCTTCAGTACAGCATGCCATGGT
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Shigella, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Shigella models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Shigella facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Shigella studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Shigella and elevate your work to new heights.