dPCR Microbial DNA Detection Assay for Bacteroides

GeneGlobe ID: DMA00992 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay
dPCR wet-lab validated
Product name​
Bacteroides
GeneGlobe Cat.No. (Assay ID)​
DMA00992
Target type​
Microbial Id
Target region​
16S rRNA gene
Target (NCBI taxonomy ID)​
Bacteroides (816)
Capsularis
Ristella
Template accession​
NR_112141.1 
Taxonomy​
Bacteria
Secondary targets/specificity​
Prevotella (838)
Application field​
Human Microbiome
Gastrointestinal Infections
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TAACGGCTCACCAAGCCTTCGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGGCGCTAGCCTGAACCAGCCAAGTAGCGTGAAGGATGAAGGCTCT
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Bacteroides, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Bacteroides models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Bacteroides facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Bacteroides studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Bacteroides and elevate your work to new heights.