GeneGlobe ID: YP00204008 | Cat. No.: 339306 | miRCURY LNA miRNA PCR Assays
hsa-miR-361-3p miRCURY LNA miRNA PCR Assay
Product Specification
Pre-designed assay for dPCR and qPCR. Wet-lab verified for qPCR and dPCR.
Targets similar miRNAs across multiple species.
Targets similar miRNAs across multiple species.
Name
hsa-miR-361-3p (YP00204008)
Species
Human (Homo sapiens)
Wet-lab verified
qPCR and dPCR wet-lab verified
Targets (mature miR)
miRBase ID
hsa-miR-361-3p
miRBase Accession
MIMAT0004682
Mature miRNA sequence
UCCCCCAGGUGUGAUUCUGAUUU
Alternative targets
mml-miR-361-3p, ppy-miR-361-3p, ptr-miR-361
Additional info (miRNA stem loop(s))
miRBase ID
hsa-mir-361
miRBase Accession
MI0000760
Description
Homo sapiens miR-361 stem-loop
miRNA sequence (pre-miR)
GGAGCUUAUCAGAAUCUCCAGGGGUACUUUAUAAUUUCAAAAAGUCCCCCAGGUGUGAUUCUGAUUUGCUUC
miRNAs amplified by this miRCURY LNA PCR Assay
hsa-miR-361-3p
Resources
Safety Data Sheets (1)
Quick-Start Protocols (3)
Scientific Posters (2)
Brochures & Guides (2)
Kit Handbooks (3)
Application Notes (1)
Supplementary Protocols (1)
Certificates of Analysis (1)
Introducing the hsa-miR-361-3p miRCURY LNA miRNA PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA PCR Assays lineup, specifically designed for RNA expression applications. This premium product offers unparalleled performance for researchers working with Bornean orangutan models. Leveraging advanced technology, the hsa-miR-361-3p miRCURY LNA miRNA PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting RNA expression, or any other sophisticated analyses, this product from our miRCURY LNA miRNA PCR Assays collection ensures optimal efficiency and reproducibility for Bornean orangutan studies. Embrace the future of research with hsa-miR-361-3p miRCURY LNA miRNA PCR Assay and elevate your work to new heights.