QiagenGeneGlobe
Custom Products Analyze Data Knowledge Services
Biological Knowledge
Genes
microRNAs
Pathways
Tools
Oligo Tools
Panel Finder
NGS Sequencing Tools
Get to Know GeneGlobe
Video Tutorials
What's new
Events and Webinars
Unlock Deeper Insights with GeneGlobe Tutorials
Unlock Deeper Insights with GeneGlobe Tutorials
Explore intuitive guides and resources designed to help you get the most out of GeneGlobe. Whether you're designing assays, browsing curated panels, or diving into analysis tools—find practical help to accelerate your research journey.
Check this out!
null
null
Schematic outline of the miRCURY LNA miRNA PCR System.
Accurate quantitation from down to 1 pg total RNA starting material.
miRCURY LNA miRNA PCR System at a glance.
Serial dilution of hsa-miR-181a.
Expression levels of reference genes in different human tissues.
LNA-enhanced primers result in greatly increased sensitivity compared to DNA primers.
Detection of differential expression of miRNAs in LCM specimens from tissue FFPE sections.
Single nucleotide discrimination.
Specific and sensitive amplification of miRNA.
Differences in miRNA expression between serum samples.
Specificity test alongside competitor probe-based miRNA qPCR system.
GeneGlobe ID: YP00206050 | Cat. No.: 339306 | miRCURY LNA miRNA PCR Assays

hsa-miR-520h miRCURY LNA miRNA PCR Assay

Product Specification

Pre-designed assay for dPCR and qPCR. Wet-lab verified for qPCR and dPCR.
Targets similar miRNAs across multiple species.
Name​
hsa-miR-520h (YP00206050)
Species​
Human (Homo sapiens)
Wet-lab verified​
qPCR and dPCR wet-lab verified
Targets (mature miR)
miRBase ID​
hsa-miR-520h
miRBase Accession​
MIMAT0002867
Mature miRNA sequence​
ACAAAGUGCUUCCCUUUAGAGU
Alternative targets​
ppy-miR-520h
Additional info (miRNA stem loop(s))
miRBase ID​
hsa-mir-520h
miRBase Accession​
MI0003175
Description​
Homo sapiens miR-520h stem-loop
miRNA sequence (pre-miR)​
UCCCAUGCUGUGACCCUCUAGAGGAAGCACUUUCUGUUUGUUGUCUGAGAAAAAACAAAGUGCUUCCCUUUAGAGUUACUGUUUGGGA
miRNAs amplified by this miRCURY LNA PCR Assay​
hsa-miR-520h

Resources

Safety Data Sheets (1)
Safety Data Sheets
Quick-Start Protocols (3)
miRCURY LNA RT Kit Quick-Start Protocol
PDF (59KB)
miRCURY LNA miRNA PCR Assays and PCR Panels Quick-Start Protocol
PDF (61KB)
miRCURY LNA miRNA PCR Assays with the QIAcuity EG PCR Kit Quick-Start Protocol
PDF (840KB)
Scientific Posters (2)
Explore the RNA Universe!
PDF (1MB)
Poster for download
Absolute quantification of miRNAs with high accuracy and precision using digital PCR
PDF (628KB)
Brochures & Guides (2)
miRCURY LNA miRNA PCR System Product Profile
PDF (488KB)
miRCURY LNA miRNA PCR System – interactive product profile
PDF (2MB)
Kit Handbooks (3)
miRCURY LNA miRNA PCR – Exosomes, Serum/Plasma and Other Biofluid Samples Handbook
PDF (757KB)
miRCURY LNA miRNA PCR Assay Handbook for the QIAcuity System
PDF (1MB)
For highly sensitive detection of miRNA using EvaGreen
miRCURY LNA miRNA SYBR® Green PCR Handbook
PDF (707KB)
For highly sensitive, real-time RT-PCR detection of miRNAs using SYBR Green
Application Notes (1)
A workflow combining high-accuracy cell sorting with digital PCR for analysis of miRNAs in defined cell pools and single cells
PDF (2MB)
Here, we present a highly efficient, high-throughput workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, to accurately analyze miRNAs in well-defined individual cells and populations of cells.
Supplementary Protocols (1)
Detection of miRNAs using miRCURY LNA miRNA PCR Panels on a QIAcuity Digital PCR System
PDF (843KB)
Certificates of Analysis (1)
Certificates of Analysis
seo_BottomDescription
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–25. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum