hsa-miR-670-3p miRCURY LNA miRNA Probe PCR Assay

GeneGlobe ID: ZP00002020 | Cat. No.: 339350 | miRCURY LNA miRNA Probe PCR Assays

Complete premixed assays containing LNA-enhanced target-specific foward primer and probe. For 200 reactions.

Product Specification

Pre-designed qPCR assay.
Name​
hsa-miR-670-3p (ZP00002020)
Species​
Human (Homo sapiens)
Wet-lab verified​
no
Targets (mature miR)
miRBase ID​
hsa-miR-670-3p
miRBase Accession​
MIMAT0026640
Mature miRNA sequence​
UUUCCUCAUAUUCAUUCAGGA
Additional info (miRNA stem loop(s))
miRBase ID​
hsa-mir-670
miRBase Accession​
MI0003933
Description​
Homo sapiens miR-670 stem-loop
miRNA sequence (pre-miR)​
GUUUAGGGGUGGACCUGAUGUCCCUGAGUGUAUGUGGUGAACCUGAAUUUGCCUUGGGUUUCCUCAUAUUCAUUCAGGAGUGUCAGUUGCCCCUUCAC
miRNAs amplified by this miRCURY LNA Probe PCR Assay​
hsa-miR-670-3p

Resources

Kit Handbooks (2)
For highly sensitive, real-time RT-PCR detection of miRNAs using hydrolysis probes
For highly sensitive, ultrafast real-time RT-PCR detection of miRNAs from exosomes, serum/plasma, and other biofluids
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the hsa-miR-670-3p miRCURY LNA miRNA Probe PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA Probe PCR Assays lineup, specifically designed for RNA expression applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the hsa-miR-670-3p miRCURY LNA miRNA Probe PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting RNA expression, or any other sophisticated analyses, this product from our miRCURY LNA miRNA Probe PCR Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with hsa-miR-670-3p miRCURY LNA miRNA Probe PCR Assay and elevate your work to new heights.