miScript miRNA Mimics

For studies on miRNA function and gene regulation using synthetic miRNA

Ready-to-transfect mimics behave like endogenous miRNAs
Available for all human, mouse, and rat miRNAs in miRBase
Highly flexible formats, scales, and grades
Easy to order via GeneGlobe

Read more on QIAGEN

Product List1 products

GeneGlobe ID: MSY0020821 | Cat. No.: 219600 | miScript miRNA Mimics

Syn-dme-miR-87-5p miScript miRNA Mimic

targets mature miRNA: dme-miR-87-5p MIMAT0020821: 5 'UCGCGCCUGUAUCUUGCUGAAC

Product Specification

Compare

You've viewed 1 of 1 Products

Load more products

Resources

Country and Language

Follow us

Contact us