Hs_HOXD11_02_PM PyroMark CpG assay
GeneGlobe ID: PM00009464 | Cat. No.: 978746 | PyroMark Q48 Autoprep: Instrument, reagents and accessories
PCR and sequencing primers for Pyrosequencing analysis of gene-specific CpG methylation after DNA bisulfite conversion (200 reactions; tube format)
Product Specification
(ENSG00000128713, ENSG00000128710, ENSG00000170178). PCR and sequencing primers for Pyrosequencing analysis of gene-specific CpG methylation after DNA bisulfite conversion (200 reactions; tube format)
GeneGlobe Id
PM00009464
Name
Hs_HOXD11_02_PM PyroMark CpG assay
Entrez genes for
ENSG00000128710
Official Name
homeobox D10
Official Symbol
HOXD10
Species
Human (Homo sapiens)
Entrez Gene ID
3236
Transcript(s) for this gene
NM_002148 (1814), ENST00000549469, ENST00000490088, ENST00000249501
Entrez genes for
ENSG00000128713
Official Name
homeobox D11
Official Symbol
HOXD11
Species
Human (Homo sapiens)
Entrez Gene ID
3237
Transcript(s) for this gene
NM_021192 (1463), ENST00000498438, ENST00000249504, ENST00000619244
Entrez genes for
ENSG00000170178
Official Name
homeobox D12
Official Symbol
HOXD12
Species
Human (Homo sapiens)
Entrez Gene ID
3238
Transcript(s) for this gene
NM_021193 (813), ENST00000404162, ENST00000406506
Additional information for this product
Amplicon Length
264 bp
Sequenced Strand
sense
Biotin Modification on 1
reverse PCR primer
Chromosomal Location GRCh37 2
Chromosome 2, BP 1769693XX-1769693XX
Chromosomal Location GRCh38 2
Chromosome 2, BP 1761046XX-1761046XX
Sequence to Analyze
YCGGGGTCTTCACGGTAGGTTCTCGAGCGGGACGCGCGGGTCCG
Sequence After Bisulfite Treatment
TYGGGGTTTTTAYGGTAGGTTTTYGAGYGGGAYGYGYGGGTTYG
Number of CpG sites included
8
Nucleotide dispensation order 3
ATCGGTTATCGTGAGTTCGTATGTCGATCGTCGTCG
Important: PyroMark CpG Assays include a downloadable Assay Setup file. This file contains all necessary setup data including nucleotide dispensation order and assay-specific settings for efficient data analysis. Designed for use with PyroMark Q24 Software 2.0, PyroMark Q24 Advanced Software, PyroMark Q96ID software version 2.5., and PyroMark CpG Software, Assay Setup files are continually updated with new information that improve the performance of the assay. Therefore, we strongly recommend downloading the Assay Setup file when purchasing a new PyroMark CpG Assay, and routinely checking for the latest version when running or reordering a PyroMark CpG Assay. To use the Assay Setup file, simply download and save it to a preferred folder on your computer. Open your software and add the folder with the Assay Setup file as a shortcut folder in the tree view.
With the nucleotide dispensation order it is possible to manually set up the Assay file needed. For your convenience however, we make available Assay setup files for PyroMark Q24 Software 2.0 (if using the PyroMark Q24), PyroMark Q24 Advanced Software (if using the PyroMark Q24 Advanced), and PyroMark Q96ID software version 2.5 (if using PyroMark Q96 ID), and PyroMark CpG Software (if using the PyroMark Q96 ID or PyroMark Q96 MD). Simply download the needed Assay setup file that corresponds to your system and save it to a preferred folder. Open your software and add the folder with the Assay setup file as a shortcut folder in the tree view.
1 The specific range of bases within a chromosome that is sequenced and analyzed with a given assay. This range is determined by the placement of the sequencing primer and the nucleotide dispensation order. The sequence begins at the first nucleotide after the sequencing primer and ends at the last nucleotide included in the "Sequence to analyze".
2 The chromosomal location is the precise location in the genome of the sequence that will be analyzed by the assay. "ChrX" indicates chromosome number. The numbers that follow are the location on that chromosome of the first and last bases of the sequence that will be analyzed by the assay.
3 Defines the nucleotides and the order in which these are added to a reaction during the Pyrosequencing run. This sequence is included in the Assay Setup file provided with each assay. We recommend to always download the latest Assay Setup file prior to running a PyroMark CpG assay.
Product Resources
File Size: 2.76 KBLanguage: English
Length: 1:36Language: English
Resources
Brochures and Guides (3)
Operating Software (3)
Protocols (9)
Technical Information (5)
User Manuals (3)
Kit Handbooks (6)
White Papers (1)
Scientific Posters (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the Hs_HOXD11_02_PM PyroMark CpG assay, a cutting-edge addition to our PyroMark Q48 Autoprep: Instrument, reagents and accessories lineup, specifically designed for Epigenetics applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the Hs_HOXD11_02_PM PyroMark CpG assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Epigenetics, or any other sophisticated analyses, this product from our PyroMark Q48 Autoprep: Instrument, reagents and accessories collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with Hs_HOXD11_02_PM PyroMark CpG assay and elevate your work to new heights.