dPCR Microbial DNA Detection Assay for Campylobacter jejuni

GeneGlobe ID: DMA00084 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Campylobacter jejuni
GeneGlobe Cat.No. (Assay ID)​
DMA00084
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Campylobacter jejuni (197)
Campylobacter fetus subsp. jejuni
Vibrio hepaticus
Vibrio jejuni
Template accession​
NC_003912.7
Taxonomy​
Bacteria
Secondary targets/specificity​
Campylobacter lari (201)
Campylobacter laridis
Campylobacter coli (195)
Campylobacter hyoilei
Vibrio coli
Campylobacter subantarcticus (497724)
Application field​
Gastrointestinal Infections
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GGTGAGTAAGGTATAGTTAATCTGCCCTACACAAGAGGACAACAGTTGGAAACGACTGCTAATACTCTATACTCCTGCTTAACACAAGTTGAGTAGGGAAAGTTTTTCGGTGTAGGATGAGACTATATAGTATCAGCTAGTTGGTAAGGTAATGGCTTACCAAGGCTATGACGCTTAACTGGTCTGAGAGGATGATCAG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 243.61 KBLanguage: English

MicrobiologyResearchAreas_Title

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Campylobacter jejuni, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Campylobacter lari models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Campylobacter jejuni facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Campylobacter lari studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Campylobacter jejuni and elevate your work to new heights.