dPCR CNV Probe Gene of Interest for FANCA

GeneGlobe ID: DCG0000153 | Cat. No.: 250210 | dPCR CNV Probe Assays

Product Specification

Gene symbol: FANCA
Ensembl Gene ID: ENSG00000187741
dPCR wet-lab verified
Product Name​
dPCR CNV Probe Gene of Interest for FANCA
GeneGlobe Cat.No. (Assay ID)​
DCG0000153
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
FANCA
Ensembl Gene ID​
ENSG00000187741
NCBI Gene Id​
2175
Strand​
Binds to reverse (3’ to 5’) bottom genome strand
Amplicon length​
92
Amplicon region​
TCTCTACAGAAGATCCACAATTCTTCGCATTGTCAGAAGAAACCTGGAAGTAGTCATCCCCTTCTAACCGTTGCTGCATACCTCTTCAGAGACTCTATAAACGCCACACGGGAGTCAGGGAC
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab verified​
dPCR wet-lab verified
Hydrolysis Probe​
FAM, ATTO550, Cy5, ATTO700
Primer Purification​
Desalted
Probe Purification​
HPLC
Reaction size​
300rxns, 500rxns and 1000rxns depending on selected dye

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 223.02 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (1)
For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System
Protocols (4)
Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
seo_BottomDescription