GeneGlobe ID: DMA00373 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Influenza A (1)
Product Specification
Viral detection assay targeting the segment 7 matrix protein gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Influenza A (1)
GeneGlobe Cat.No. (Assay ID)
DMA00373
Target type
Microbial Id
Target region
Segment 7 matrix protein gene
Target (NCBI taxonomy ID)
Influenza A virus (11320)
FLUAV
Human Influenza A Virus
influenza A virus
Influenza virus type A
FLUAV
Human Influenza A Virus
influenza A virus
Influenza virus type A
Template accession
KJ028475.1
Taxonomy
Viruses
Application field
Human Pathogens
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - TAMRA
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
AGTGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAAGGGATTTTGGGATTTGTATTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGGAAATGGAGA
Reaction size
200rxns
Product Resources
File Size: 255.56 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Influenza A (1), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Influenza A virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Influenza A (1) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Influenza A virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Influenza A (1) and elevate your work to new heights.