GeneGlobe ID: DMA00379 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Respiratory syncytial virus (1)
Product Specification
Viral detection assay targeting the matrix protein gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Respiratory syncytial virus (1)
GeneGlobe Cat.No. (Assay ID)
DMA00379
Target type
Microbial Id
Target region
Matrix protein gene
Target (NCBI taxonomy ID)
Respiratory syncytial virus (12814)
respiratory syncytial virus RS
respiratory syncytial virus RSV
respiratory syncytial virus RS virus
RSV
respiratory syncytial virus RS
respiratory syncytial virus RSV
respiratory syncytial virus RS virus
RSV
Template accession
KJ723482.1
Taxonomy
Viruses
Application field
Human Pathogens
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
AAAAGAACAAGATGGGGCAAATATGGAAACATACGTGAACAAGCTTCACGAAGGCTCCACATACACAGCAGCTGTTCAGTACAATGTTCTAGAAAAAGATGATGATCCTGCATC
Reaction size
200rxns
Product Resources
File Size: 243.63 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Respiratory syncytial virus (1), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Respiratory syncytial virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Respiratory syncytial virus (1) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Respiratory syncytial virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Respiratory syncytial virus (1) and elevate your work to new heights.