The following mature miRNA have the same seed sequence: GGACGGA
| ID | hsa-miR-184 |
| Accession | MIMAT0000454 |
| Sequence | 53 - UGGACGGAGAACUGAUAAGGGU - 74 |
| Seed Sequence | GGACGGA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- ERBB2
- beta-eleostearic acid
- linoelaidic acid
disease
- non-insulin-dependent diabetes mellitus
- neoplasia
- idiopathic pulmonary fibrosis
- metastasis
- small cell lung cancer
- organismal death
- endometrioid endometrial adenocarcinoma
- lupus nephritis
- bladder neoplasm
- bladder neoplasia
role in cell
- expression in
- proliferation
- phosphorylation in
- surface area
- sealing in