The following mature miRNA have the same seed sequence: ACUGGCC
| ID | hsa-miR-193a-3p |
| Accession | MIMAT0000459 |
| Sequence | 55 - AACUGGCCUACAAAGUCCCAGU - 76 |
| Seed Sequence | ACUGGCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- non-small cell lung cancer
- epithelial cancer
- breast cancer
- hepatocellular carcinoma
- liver cancer
- nonobstructive azoospermia
- sporadic amyotrophic lateral sclerosis
- metastasis
- psoriasis
role in cell
- cell death
- proliferation
- growth
- phosphorylation in
- expression in
- migration
- cell proliferation
- cell cycle progression
- invasion by
- colony formation by