The following mature miRNA have the same seed sequence: CCUGCUG
| ID | hsa-miR-370-3p |
| Accession | MIMAT0000722 |
| Sequence | 48 - GCCUGCUGGGGUGGAACCUGGU - 69 |
| Seed Sequence | CCUGCUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- organismal death
- non-insulin-dependent diabetes mellitus
- bladder cancer
- sickle cell anemia
- systemic sclerosis
- deep vein thrombosis
- intrahepatic cholestasis of pregnancy
role in cell
- expression in
- proliferation
- migration
- invasion by
- invasiveness
- temozolomide resistance