The following mature miRNA have the same seed sequence: GUGGGGA
| ID | hsa-miR-491-5p |
| Accession | MIMAT0002807 |
| Sequence | 16 - AGUGGGGAACCCUUCCAUGAGG - 37 |
| Seed Sequence | GUGGGGA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- metastasis
- organismal death
- small cell lung cancer
role in cell
- proliferation
- activation in
- disruption
- apoptosis
- disruption in
- expression in
- migration
- inhibition in
- invasion by
- number