The following mature miRNA have the same seed sequence: CGACCCA
| ID | hsa-miR-551a |
| Accession | MIMAT0003214 |
| Sequence | 61 - GCGACCCACUCUUGGUUUCCA - 81 |
| Seed Sequence | CGACCCA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- psoriasis
- nonobstructive azoospermia
- primary open-angle glaucoma
- papillary thyroid cancer