The following mature miRNA have the same seed sequence: AAUCAGC
| ID | hsa-miR-34a-3p |
| Accession | MIMAT0004557 |
| Sequence | 64 - CAAUCAGCAAGUAUACUGCCCU - 85 |
| Seed Sequence | AAUCAGC |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- TP53
- CpG ODN 1826
disease
- epithelial cancer
- malignant mesothelioma
- mesothelioma formation
- nonobstructive azoospermia