The following mature miRNA have the same seed sequence: GAAUCAU
| ID | hsa-miR-15b-3p |
| Accession | MIMAT0004586 |
| Sequence | 58 - CGAAUCAUUAUUUGCUGCUCUA - 79 |
| Seed Sequence | GAAUCAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- primary open-angle glaucoma
- mammary neoplasm
regulated by
- sodium dichromate
- AGO2