The following mature miRNA have the same seed sequence: GACCGAU
| ID | hsa-miR-29c-5p |
| Accession | MIMAT0004673 |
| Sequence | 16 - UGACCGAUUUCUCCUGGUGUUC - 37 |
| Seed Sequence | GACCGAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- small cell lung cancer
- rheumatoid arthritis
- nonobstructive azoospermia
- early rheumatoid arthritis
- systemic sclerosis
- idiopathic pulmonary fibrosis
regulated by
role in cell
- proliferation
- colony formation
- invasion by