The following mature miRNA have the same seed sequence: GGGGUGC
| ID | hsa-miR-342-5p |
| Accession | MIMAT0004694 |
| Sequence | 19 - AGGGGUGCUAUCUGUGAUUGA - 39 |
| Seed Sequence | GGGGUGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
disease
- sepsis
- chronic epilepsy
- infantile hemangioma formation
- nasal type extranodal NK-/T-cell lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- natural killer cell neoplasia
- kainic acid-induced epileptic seizure
- adult T-cell leukemia/lymphoma