The following mature miRNA have the same seed sequence: CCUCUUC
| ID | hsa-miR-877-3p |
| Accession | MIMAT0004950 |
| Sequence | 66 - UCCUCUUCUCCCUCCUCCCAG - 86 |
| Seed Sequence | CCUCUUC |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- intrahepatic cholestasis of pregnancy
- infiltrating ductal breast carcinoma
- invasive ductal breast cancer
regulated by
- TP53
- vorinostat