The following mature miRNA have the same seed sequence: CAGGAAC
| ID | hsa-miR-873-5p |
| Accession | MIMAT0004953 |
| Sequence | 11 - GCAGGAACUUGUGAGUCUCCU - 31 |
| Seed Sequence | CAGGAAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- glioblastoma
- overall survival
- nasal type extranodal NK-/T-cell lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- natural killer cell neoplasia
- pilocarpine-induced status epilepticus
- chronic epilepsy
- glioblastoma cancer
role in cell
- expression in
- proliferation
- migration
- invasion by