QiagenGeneGlobe
Applications
Custom ProductsAnalyze DataKnowledgeToolsServices
0 Cart
GeneGlobe ID: DCG0000180 | Cat. No.: 250210 | dPCR CNV Probe Assays

dPCR CNV Probe Gene of Interest for EGFR

Gene symbol: EGFR
Ensembl Gene ID: ENSG00000146648
dPCR wet-lab validated

Select a variant to see the price

Product Specification

Product Name​
dPCR CNV Probe Gene of Interest for EGFR
GeneGlobe Cat.No. (Assay ID)​
DCG0000180
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
EGFR
Ensembl Gene ID​
ENSG00000146648
NCBI Gene Id​
1956
Strand​
Binds to forward (5’ to 3’) top genome strand
Amplicon length​
141
Amplicon region​
GGCAGCAGAGCTCCTGCTCTTCTTTGTCCTCATATACGAGCACCTCTGGACTTAAAACTTGAGGAACTGGATGGAGAAAAGTTAATGGTCAGCAGCGGGTTACATCTTCTTTCATGCGCCTTTCCATTCTTTGGATCAGTAGTCACTAACGTTCGCCAGCCATAAGTCCTC
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab validated​
dPCR wet-lab validated
Hydrolysis Probe​
FAM, ATTO 550, Cy5
Primer Purification​
Desalted
Probe Purification​
HPLC

Product Resources

Validation Data
File Size: 232.42 KBLanguage: English

Resources

Kit Handbooks (2)
Custom dPCR CNV Probe Assays Product Sheet
PDF (74KB)
dPCR Copy Number Variation (CNV) Probe Assays Handbook
PDF (320KB)
Application Notes (1)
A workflow combining high-accuracy cell sorting with multiplex digital PCR for mitochondrial and genomic target copy number analysis
PDF (2MB)
Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.
Scientific Posters (1)
Detection of rare events using the QIAcuity Digital PCR System
PDF (1MB)
Quick-Start Protocols (1)
dPCR CNV Probe Assays Quick Start Protocol
PDF (86KB)
Brochures & Guides (1)
dPCR CNV Probe Assays Product Profile
PDF (736KB)
For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System
Safety Data Sheets (1)
Safety Data Sheets
Certificates of Analysis (1)
Certificates of Analysis
Introducing the dPCR CNV Probe Gene of Interest for EGFR, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for EGFR facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for EGFR and elevate your work to new heights.
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–24. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum